Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

Search Within Results

1 – 15 of 117 results

Invitrogen™ ELISA TMB Stabilized Chromogen

For use with all sandwich ELISAs which utilize Horseradish Peroxidase (HRP) as detecting enzyme

Pricing & Availability

Invitrogen™ Dynabeads™ Untouched™ Mouse CD8 Cells Kit

Dynabeads™ Untouched™ Mouse CD8 Cells supplies both 4.5 μm superparamagnetic Dynabeads (with a polyclonal sheep anti-rat IgG antibody covalently bound to the bead surface) and a monoclonal Antibody Mix.

Pricing & Availability

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

MilliporeSigma™ Upstate™ E2F-1α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,ChIP sequencing (ChIP-seq),Immunoprecipitation
Form	Purified
Gene Accession No.	Q01094
Isotype	IgG
Includes	This ChIPAb+ E2F-1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	E2F-1α
Regulatory Status	RUO
Gene Symbols	E2F1, RBAP-1, E2F-1, RBP3, RBBP3, RBBP-3, PBR3
Purification Method	Protein G purified
Gene ID (Entrez)	NP_005216
Formulation	Anti-E2F-1 (mouse monoclonal). One vial containing 25μg of protein G purified monoclonal mixed IgG in 25μL of buffer containing 0.1 M Tris-glycine, pH 7.4, 0.15 M NaCl with 0.05% sodium azide. Frozen solution. Nornal Mouse IgG. One vial containing 25μg of purified IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, CDC2 promoter. One vial containing 75μL of 5μM each primer specific for human CDC2 promoter. FOR: CGC CCT TTC CTC TTT CTT TC; REV: ATC GGG TAG CCC GTA GAC TT
Immunogen	GST fusion protein corresponding to full-length human E2F-1.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	The epitopes have been mapped to amino acids 1 to 89 and to amino acids 342 to 386.

MilliporeSigma™ Upstate™ CREBα, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Culture Supernatant
Gene Accession No.	P16220
Isotype	IgG
Includes	This ChIPAb+ CREB -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	CREBα
Regulatory Status	RUO
Gene Symbols	CREB1, MGC9284, CREB
Gene ID (Entrez)	NP_004370
Formulation	25 assays per set. Recommended use: ∽10μL antibody per chromatin immunoprecipitation (dependent upon biological context).
Immunogen	CREB purified antibody is made against a KLH-conjugated synthetic peptide corre-sponding to amino acids 5-24 of human CREB.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes CREB, MW ∽43kDa.

MilliporeSigma™ Upstate™ Sox-2, clone 6F1.2α, 6F1.2, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Dot Blot,Immunocytochemistry,Western Blot
Form	Purified
Gene Accession No.	P48431
Isotype	IgG2b κ
Includes	This ChIPAb+ Sox-2, clone 6F1.2 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Sox-2, clone 6F1.2α
Regulatory Status	RUO
Gene Symbols	SOX2; ANOP3; MGC2413; MCOPS3
Gene ID (Entrez)	NP_003097
Formulation	Anti-Sox-2, clone 6F1.2 (mouse monoclonal IgG). One vial containing 100μg of protein A purified antibody in 140μL of 0.02M phosphate buffer pH 7.6 with 0.25M NaCl containing 0.1% sodium azide, and 30% glycerol. ChIP Primers, nanog promoter. One vial containing 75μL of 5μM of each primer specific for the promoter region of human nanog. FOR: GTT CTG TTG CTC GGT TTT CT; REV: TCC CGT CTA CCA GTC TCA CC
Immunogen	Recombinant GST Fusion protein.
Classification	Monoclonal
Primary or Secondary	Primary
Clone	6F1.2
Test Specificity	Recognizes Sox-2, MW: ∽34kDa.

MilliporeSigma™ Upstate™ JMJD6, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Gene Accession No.	Q6NYC1
Includes	This ChIPAb+ JMJD6 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	JMJD6
Regulatory Status	RUO
Gene Symbols	JMJD6, PTDSR1, PTDSR, PSR
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_001074930
Formulation	Anti-JMJD6 (rabbit polyclonal). One vial containing 50μL of purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl and 0.05% sodium azide before the addition of glycerol to 30%. Concentration: 0.7mg/mL. Normal Rabbit IgG. One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, human β-globin. One vial containing 75μL of each primer (5μM) specific for the human β-globin promoter. FOR: AGG ACA GGT ACG GCT GTC ATC; REV: TTT ATG CCC AGC CCT GGC TC
Immunogen	Linear peptide corresponding to human JMJD6.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes JMJD6.

MilliporeSigma™ Upstate™ SMRTα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Electromobility Shift Assay,Immunocytochemistry,Immunohistochemistry,Immunoprecipitation,Western Blot
Form	Ascites
Gene Accession No.	Q9Y618
Isotype	IgG2a κ
Includes	The ChIPAb+ SMRT set includes the SMRT antibody, a negative control mouse ascites and qPCR primers which amplify a 299bp region of human IκBα promoter.
Antigen	SMRTα
Regulatory Status	RUO
Gene Symbols	NCOR2, CTG26, N-CoR2, SMAP270, SMRT, SMRTE, SMRTE-tau, TNRC14, TRAC, TRAC-1, TRAC1
Purification Method	Unpurified
Gene ID (Entrez)	NP_001070729.1
Formulation	Anti-SMRT (mouse monoclonal). One vial containing 50μL of unpurified mouse monoclonal ascites with 0.05% sodium azide. Negative Ascites (mouse). One vial containing 50μL of mouse ascites with 0.05% sodium azide. ChIP Primers, IκBα promoter. One vial containing 75μL of 5μM of each primer specific for human IĸBα promoter. FOR: GAC GAC CCC AAT TCA AAT CG; REV: TCA GGC TCG GGG AAT TTC C
Immunogen	Recombinant protein corresponding to human SMRT.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes SMRT.

MilliporeSigma™ Upstate™ Phospho-Histone H3 (Ser10)α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	P84243
Isotype	IgG
Includes	This ChIPAb+ Phospho-Histone H3 (Ser10) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Phospho-Histone H3 (Ser10)α
Regulatory Status	RUO
Gene Symbols	H3F3; H3.3B; MGC87782; MGC87783; H3.3A
Purification Method	Protein G purified
Gene ID (Entrez)	NM_003493
Formulation	Anti-phospho-Histone H3 (Ser10) (mouse monoclonal IgG, Clone CMA312). One vial containing 50μg protein G-purified antibody in 50μL PBS containing 0.05% sodium. Normal Mouse IgG. Two vials containing 25μg purified mouse IgG in 25μL storage buffer containing 0.1% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for the promoter region of human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	Immunogen was a synthetic peptide corresponding to amino acids 1-19 of histone H3,phosphorylated at Ser10.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes histone H3, Mr 17kDa, phosphorylated at Ser10.

MilliporeSigma™ Upstate™ ChIPAb+™ Dimethyl-Histone H3 (Lys79)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Culture Supernatant
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Dimethyl-Histone H3 (Lys79) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	ChIPAb+™ Dimethyl-Histone H3 (Lys79)α
Regulatory Status	RUO
Gene Symbols	H3F3A, H3F3B
Gene ID (Entrez)	NM_003493
Formulation	Anti-Dimethyl-Histone H3 (Lys79) (rabbit Monoclonal), One vial containing 100μL of cultured supernatant in 0.05% sodium azide. Negative Control Supernatant, One vial containing 100μL of cultured supernatant in 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	KLH-conjugated synthetic peptide containing the sequence DF_me2KTD corresponding to dimethyl-lysine at position 79 of histone H3. The immunizing sequence is identical in human,mouse,rat and yeast. A C-terminal cysteine was added to facilitate conjugation.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes dimethyl-histone H3 (Lys79).

MilliporeSigma™ Upstate™ REST, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q13127
Includes	This ChIPAb+ REST -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	REST
Regulatory Status	RUO
Gene Symbols	NRSF, XBR
Gene ID (Entrez)	NP_005603
Formulation	Anti-REST (Rabbit Polyclonal). One vial containing 100μL 1.0mg/mL purified rabbit polyclonal in buffer containing 0.014M phosphate buffer, pH 7.6, 0.175M NaCl, 0.07% sodium azide, and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, human Snap25. One vial containing 75μL of 5μM of each primer specific for human Snap25 promoter. FOR: AGA CTC CTT TGC AGA CAA TTT CCT; REV: CAA CAC AGA AGA TTT CCA CAA GTA GAC
Immunogen	The REST purified antibody is made against a GST fusion protein corresponding to amino acids 801-1097 of human REST.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes REST, MW 125kDa predicted, 200kDa observed.

MilliporeSigma™ Upstate™ TCF-4α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Dot Blot,Western Blot
Form	Purified
Gene Accession No.	Q9NQB0
Isotype	IgG2a
Includes	This ChIPAb+ TCF-4 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	TCF-4α
Regulatory Status	RUO
Gene Symbols	TCF4, TCF-4, TCF7L2
Purification Method	Protein G chromatography
Gene ID (Entrez)	CAB97213.1
Formulation	Anti-TCF-4 (mouse monoclonal). One vial containing 50μg of purified mouse monoclonal IgG2a in 50μL of buffer containing 0.1 M Tris-glycine, pH 7.4, 0.15 M NaCl, 0.05% sodium azide and 30% glycerol. Normal Mouse IgG. Two vials containing 25μg of purified IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, SP5 promote. One vial containing 75μL of 5μM of each primer specific for human SP5 promotor. FOR: GGG TCT CCA GGC GGC AAG; REV: AGC GAA AGC AAA TCC TTT GAA TCC
Immunogen	Amino acids 31-331 of human TCF-4.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes TCF-4

MilliporeSigma™ Upstate™ JMJD1C, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Immunocytochemistry,Western Blot
Gene Accession No.	Q15652
Includes	This ChIPAb+ JMJD1C -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	JMJD1C
Regulatory Status	RUO
Gene Symbols	TRIP8, RP11-10C13.2, JMJD1C, JHDM2C
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_116165
Formulation	Anti-JMJD1C (rabbit polyclonal). One vial containing 50μL of purified rabbit polyclonal in buffer containing 0.1 M Tris-Glycine (pH 7.4), 150mM NaCl and 0.05% sodium azide before the addition of glycerol to 30%. Concentration: 0.7mg/mL. Normal Rabbit IgG. One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, human β-globin. One vial containing 75μL of each primer (5μM) specific for the human β-globin promoter. FOR: AGG ACA GGT ACG GCT GTC ATC; REV: TTT ATG CCC AGC CCT GGC TC
Immunogen	KLH-conjugated linear peptide corresponding to human JMJD1C.
Classification	Polyclonal
Primary or Secondary	Primary

MilliporeSigma™ Upstate™ SUZ12α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Dot Blot,Western Blot
Form	Purified
Gene Accession No.	Q15022
Isotype	IgG1 κ
Includes	This ChIPAb+ SUZ12 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	SUZ12α
Regulatory Status	RUO
Gene Symbols	SUZ12; JJAZ1; ChET9
Gene ID (Entrez)	NP_056170
Formulation	Anti-SUZ12 (mouse monoclonal IgG). One vial containing 50μg of protein A purified antibody in PBS containing 0.05% sodium azide. May contain 30% glycerol (see certificate of analysis). Normal Mouse IgG. Two vials containing 25μg of purified mouse IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, HoxA2 upstream. One vial containing 75μL of 5μM of each primer specific for the promoter region of human HoxA2. FOR: AGG AAA GAT TTT GGT TGG GAA G; REV: AAA AAG AGG GAA AGG GAC AGA C
Immunogen	SUZ12,purified antibody is made against human SUZ12.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes SUZ12, Mr 95kDa.

MilliporeSigma™ Upstate™ Phospho-Histone H3 (Ser28), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Immunocytochemistry,Inhibition Assays,Western Blot
Gene Accession No.	Q16695
Includes	This ChIPAb+ Phospho-Histone H3 (Ser28) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Phospho-Histone H3 (Ser28)
Regulatory Status	RUO
Gene Symbols	HIST3H3, H3FT
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_003484.1
Formulation	Anti- Phospho-Histone H3 (Ser28) (Rabbit Polyclonal). One vial containing 125μl of purified rabbit polyclonal IgG in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl with 0.05% sodium azide before the addition of 30% glycerol. Normal Rabbit IgG. Two vials containing 75μL of normal rabbit IgG in buffer containing 0.01M PBS with 0.1% sodium azide. ChIP Primers, human GAPDH promoter. One vial containing 75μL of 5μM each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	KLH-conjugated linear peptide corresponding to Histone H3 phosphorylated at Ser28.
Classification	Polyclonal
Primary or Secondary	Primary

Antibody Panels and Kits

Filtered Search Results

Narrow Results