Organophosphorus compounds
Medchemexpress LLC hsa-miR-214-3p mimic 5nmol | 5nmol
hsa-miR-214-3p mimics are small chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity
Medchemexpress LLC hsa-miR-185-3p mimic 5nmol | 5nmol
hsa-miR-185-3p mimics are small chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity
Medchemexpress LLC hsa-miR-30e-3p mimic 5nmol | 5nmol
hsa-miR-30e-3p mimics are small chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity
Medchemexpress LLC Tetradecyl acetate | 638-59-5 | MFCD00053737 | 98.5% | 256.42 g/mol | C16H32O2 | 100 G
Tetradecyl acetate is a high-purity chemical standard used as a sex pheromone for entomological research, analytical reference, and pest mating-disruption studies. It is supplied with supporting documentation for analytical and safety use.
- High purity for analytical applications (98.5%).
- Molecular formula C16H32O2 and molecular weight 256.42 g/mol.
- Contains CAS number 638-59-5 for chemical identification.
- Available in multiple pack sizes, including 100 g.
- Includes datasheet, certificate of analysis, safety data sheet, and spectral reports.
- Suitable for pheromone research and mating-disruption studies.
Medchemexpress LLC mmu-miR-378a-3p inhi 5nmol | 5nmol
mmu-miR-378a-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs The miRNA inhibitors have full-length nucleotide 2 -methoxy modification The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes thereby inhibiting miRNAs from functioning
Medchemexpress LLC hsa-miR-195-3p inhib 5nmol | 5nmol
hsa-miR-195-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs The miRNA inhibitors have full-length nucleotide 2 -methoxy modification The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes thereby inhibiting miRNAs from functioning
Medchemexpress LLC hsa-miR-30e-3p inhib 20nmol | 20nmol
hsa-miR-30e-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs The miRNA inhibitors have full-length nucleotide 2 -methoxy modification The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes thereby inhibiting miRNAs from functioning
Medchemexpress LLC Rna, (cuagugguccuaaacauuuc) (full-length nucleotide 2'-methoxy modification) | 98.2% | 6569.33 | 20 NMOL
Hsa-miR-203a-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature microRNAs. These inhibitors feature full-length nucleotide 2'-methoxy modification, allowing them to strongly compete with mature microRNAs. This competition prevents the complementary pairing of microRNAs and their target genes, effectively inhibiting microRNA function.
- Chemically-modified oligonucleotides
- Full-length nucleotide 2'-methoxy modification
- Inhibits microRNA function
- For research use only
- Molecular weight: 6569.33
- Purity: 98.21%
- Available in various sizes, including 20 nmol
- Recommended storage at -20°C, sealed and away from moisture
- Appearance as a white to off-white solid
Medchemexpress LLC DPPF (1,1'-Ferrocenediyl-bis(diphenylphosphine)) | 12150-46-8 | 554.38 | 25 G
DPPF (1,1'-Ferrocenediyl-bis(diphenylphosphine)) is a metal ligand that enhances the stability of metal complexes. It is suitable for use as a laboratory chemical in the manufacture of substances and for research in ovarian cancer.
- Enhances the stability of metal complexes
- Functions as a metal ligand
- Applicable in ovarian cancer research
- Used as a biochemical assay reagent
Medchemexpress LLC hsa-miR-296-3p agomi 20nmol | 20nmol
hsa-miR-296-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand 2 phosphorothioates at the 5 end 4 phosphorothioates at the 3 end 3 end cholesterol group and full-length nucleotide 2 -methoxy modification They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies Compared with miRNA mimics they exhibits enhanced cellular uptake stability and regulatory activity in vivo
Medchemexpress LLC hsa-miR-302d-3p agom 5nmol | 5nmol
hsa-miR-302d-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand 2 phosphorothioates at the 5 end 4 phosphorothioates at the 3 end 3 end cholesterol group and full-length nucleotide 2 -methoxy modification They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies Compared with miRNA mimics they exhibits enhanced cellular uptake stability and regulatory activity in vivo
Medchemexpress LLC hsa-miR-302d-3p agom 20nmol | 20nmol
hsa-miR-302d-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand 2 phosphorothioates at the 5 end 4 phosphorothioates at the 3 end 3 end cholesterol group and full-length nucleotide 2 -methoxy modification They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies Compared with miRNA mimics they exhibits enhanced cellular uptake stability and regulatory activity in vivo
Medchemexpress LLC Tetradecyl acetate | 638-59-5 | MFCD00053737 | 256.42 g/mol | C16H32O2 | 50 G
Tetradecyl acetate is a naturally occurring insect sex pheromone (myristyl acetate) produced by Ctenopseustis obliquana females and used in pheromone research, mating disruption studies, and as an analytical standard.
- Sex pheromone produced by Ctenopseustis obliquana females.
- Used to disrupt mating of pest species.
- Suitable as an analytical standard for research and analytical applications.
- Chemical formula C16H32O2; molecular weight 256.42 g/mol.
Medchemexpress LLC rno-miR-223-3p antag 20nmol | 20nmol
rno-miR-223-3p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs The miRNA antagomirs have 2 phosphorothioates at the 5 end 4 phosphorothioates at the 3 end 1 cholesterol group at the 3 end and full-length nucleotide 2 -methoxy modification The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes thereby inhibiting miRNAs from functioning Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors they exhibits enhanced cellular uptake stability and regulatory activity in vivo